Opie2-NeoR[traF]+Opie2-PuroR[dsxM]
(Plasmid
#131618)
-
PurposeExpresses a functional NeoR only in females, a functional PuroR only in males, and dsRed in both genders.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131618 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePiggyBac
- Backbone size w/o insert (bp) 5200
- Total vector size (bp) 15465
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePuroR[dsxM]
-
Alt namePuroR with Dsx male-specific intron encoded into PuroR CSD.
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)5680
- Promoter Opie2
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAAGTTTTAATCGCATAACTTCTGTTAATCCCC
- 3′ sequencing primer ggtgtcaggcaccgggcttgcgggtc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNeoR[traF]
-
Alt nameNeoR with Tra female-specific intron encoded into NeoR CDS.
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1043
- Promoter Opie2
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer atgGTACCCACTATATAGTATAACCGATCTG
- 3′ sequencing primer gatctTTAGAAGAACTCATCCAGCAAGCGGTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Opie2-NeoR[traF]+Opie2-PuroR[dsxM] was a gift from Omar Akbari (Addgene plasmid # 131618 ; http://n2t.net/addgene:131618 ; RRID:Addgene_131618) -
For your References section:
A drug-inducible sex-separation technique for insects. Kandul NP, Liu J, Hsu AD, Hay BA, Akbari OS. Nat Commun. 2020 Apr 30;11(1):2106. doi: 10.1038/s41467-020-16020-2. 10.1038/s41467-020-16020-2 PubMed 32355156