Skip to main content
Addgene

pPROEX Hsp104 (773-908)
(Plasmid #1316)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 1316 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPROEX-HTb
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4746
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hsp104 (773-908)
  • Alt name
    Hsp104
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    537
  • Mutation
    deletion of aa1-773
  • Entrez Gene
    HSP104 (a.k.a. YLL026W)
  • Tag / Fusion Protein
    • 6X His + TEV cleavage (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer TACGATATCCCAACGACCGAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPROEX Hsp104 (773-908) was a gift from Susan Lindquist (Addgene plasmid # 1316 ; http://n2t.net/addgene:1316 ; RRID:Addgene_1316)
  • For your References section:

    Defining a pathway of communication from the C-terminal peptide binding domain to the N-terminal ATPase domain in a AAA protein. Cashikar AG, Schirmer EC, Hattendorf DA, Glover JR, Ramakrishnan MS, Ware DM, Lindquist SL. Mol Cell 2002 Apr;9(4):751-60. 10.1016/S1097-2765(02)00499-9 PubMed 11983167