Skip to main content
Addgene

pMXs-Etv6
(Plasmid #131599)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131599 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXs
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 6100
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Etv6
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1500
  • Entrez Gene
    Etv6 (a.k.a. AW123102, AW557856, Tel)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HPA (unknown if destroyed)
  • 5′ sequencing primer gacggcatcgcagcttggat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-Etv6 was a gift from Kateri Moore & Filipe Pereira (Addgene plasmid # 131599 ; http://n2t.net/addgene:131599 ; RRID:Addgene_131599)
  • For your References section:

    Induction of a hemogenic program in mouse fibroblasts. Pereira CF, Chang B, Qiu J, Niu X, Papatsenko D, Hendry CE, Clark NR, Nomura-Kitabayashi A, Kovacic JC, Ma'ayan A, Schaniel C, Lemischka IR, Moore K. Cell Stem Cell. 2013 Aug 1;13(2):205-18. doi: 10.1016/j.stem.2013.05.024. Epub 2013 Jun 13. 10.1016/j.stem.2013.05.024 PubMed 23770078