Ad-mMKP3 S159A S197A-Flag
(Plasmid #131579)

• Purpose: Expresses MKP-3 with S159A mutation and S197A mutation in mammalian cells
• Depositing Lab: Haiyan Xu
• Publication: Bacterial expression plasmids for MKP3 with mutation and Flag (unpublished)

Backbone

• Vector backbone: pAd/CMV/V5-DEST
• Backbone manufacturer: Invitrogen (Life Technologies)
• Backbone size w/o insert (bp): 36686
• Total vector size (bp): 37856
• Vector type: Adenoviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Mitogen-activated protein kinase phosphatase 3
• Alt name: Mkp-3
• Species: M. musculus (mouse)
• Insert Size (bp): 1170
• Mutation: changed Serine 159 to Alanine and Serine 197 to Alanine
• GenBank ID: NM_026268.3
• Entrez Gene: Dusp6 (a.k.a. 1300019I03Rik, MKP-3, MKP3, PYST1)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: T7 primer TAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry