pCAG-T3-CjCAS9-pA
(Plasmid #131543)

• Purpose: Expresses Campylobacter jejuni-derived Cas9 nuclease in mammalian cells. Used to modify genome of mouse embroys
• Depositing Lab: Wataru Fujii
• Publication: Fujii et al Int J Mol Sci. 2017 Oct 31;18(11). pii: ijms18112286. doi: 10.3390/ijms18112286.

Backbone

• Vector backbone: pCAG-T3-hCAS9-pA
• Total vector size (bp): 8538
• Modifications to backbone: The human codon optimized CjCas9 ORF was inserted into the NotI to ClaI site of pCAG-T3-hCAS9-pA plasmid (Addgene #48625).
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CjCas9
• Alt name: CjeCas9
• Species: Synthetic; Campylobacter jejuni
• Insert Size (bp): 3051
• Mutation: Human codon-optimized
• Promoter: CAG, T3
• Tags / Fusion Proteins:
  • FLAG-SV40NLS (N terminal on insert)
  • SV40NLS (C terminal on insert)
  • polyA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: TGGGCAACGTGCTGGTTATTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry