Ad-FOXO1 1-360
(Plasmid
#131533)
-
PurposeExpresses FOXO1 1-360 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131533 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAd/CMV/V5-DEST
-
Backbone manufacturerInvitrogen (Life Technologies)
- Backbone size w/o insert (bp) 36686
- Total vector size (bp) 37769
-
Modifications to backboneNo
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameForkhead box O1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1083
-
Mutationonly reserved amino acid 1-360
-
GenBank IDNM_019739.3
-
Entrez GeneFoxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
- Promoter CMV
-
Tag
/ Fusion Protein
- No
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer T7 primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ad-FOXO1 1-360 was a gift from Haiyan Xu (Addgene plasmid # 131533 ; http://n2t.net/addgene:131533 ; RRID:Addgene_131533) -
For your References section:
Mapping MKP-3/FOXO1 interaction and evaluating the effect on gluconeogenesis. Jiao P, Feng B, Xu H. PLoS One. 2012;7(7):e41168. doi: 10.1371/journal.pone.0041168. Epub 2012 Jul 25. 10.1371/journal.pone.0041168 PubMed 22848439