pFUGW mCherry-KASH
(Plasmid #131505)

• Purpose: mCherry_KASH epression under hUBC promotor; serves as backbone for ORANGE lenti knock-in
• Depositing Lab: Harold MacGillavry
• Publication: Willems et al PLoS Biol. 2020 Apr 10;18(4):e3000665. doi: 10.1371/journal.pbio.3000665.

Backbone

• Vector backbone: pFUGW
• Backbone size w/o insert (bp): 10198
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry_KASH
• Species: Synthetic
• Promoter: hUBC

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: GGCGAGTGTGTTTTGTGAAG
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Resource Information

• Supplemental Documents:
  • pFUGW mCherry-KASH.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry