pORANGE Cloning template vector
(Plasmid #131471)

• Purpose: (Empty Backbone) Cloning template form ORANGE method based knock-in constructs
• Depositing Lab: Harold MacGillavry
• Publication: Willems et al PLoS Biol. 2020 Apr 10;18(4):e3000665. doi: 10.1371/journal.pbio.3000665.

Backbone

• Vector backbone: pORANGE
• Backbone size (bp): 8494
• Vector type: Mammalian Expression
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SpCas9
• Species: S. pyogenes
• Promoter: U6 and Cbh
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: aaggctgttagagagataattggaa
• 3′ sequencing primer: cgggccatttaccgtaagtt

Resource Information

• Supplemental Documents:
  • pORANGE Cloning template vector.gb
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry