pCRISPR-aBEST
(Plasmid #131464)

• Purpose: Expression of a Streptomyces codon optimized Cas9n-tadA fusion protein in pGM1190. A to G base editor for actinomycetes
• Depositing Lab: Tilmann Weber
• Publication: Tong et al Proc Natl Acad Sci U S A. 2019 Oct 8;116(41):20366-20375. doi: 10.1073/pnas.1913493116. Epub 2019 Sep 23.

Backbone

• Vector backbone: pGM1190
• Backbone size w/o insert (bp): 6971
• Total vector size (bp): 12452
• Vector type: CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Streptomyces codon optimized spCas9n (D10A)
• Species: Synthetic; Streptomyces
• Insert Size (bp): 4104
• GenBank ID: KR011748
• Promoter: tipA

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcggcagcagcggcggctcggacaagaagtactccatcgg
• 3′ sequencing primer: ggggatcctctagaaagctttcagtcgccgccgagctggg

Gene/Insert 2

• Gene/Insert name: streptomyces codon optimized tadA
• Species: Synthetic; Streptomyces
• Insert Size (bp): 1191
• Promoter: tipA

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAGAGAAGGGAGCGGACAtatgagcgaggtcgagttctc
• 3′ sequencing primer: cgagccgccgctgctgccgc

Resource Information

• Supplemental Documents:
  • pCRISPR-aBEST.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry