EcNGsC-S308V-pKK223
(Plasmid
#131393)
-
PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308V in Gs MutY.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKK223
- Backbone size w/o insert (bp) 4577
- Total vector size (bp) 5663
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEcNGsC MutY chimera S308V
-
Alt nameS308V EcNGsC
-
Alt nameS308V
-
SpeciesE. coli and Geobacillus stearothermophilus
-
Insert Size (bp)1086
-
MutationFusion of two MutY genes. Residues 1-225 are from E.coli MutY and residues 226-360 correspond with residues 231-365 of G.stearothermophilus MutY. Amino acid change S308V in Gs MutY, corresponding with position 303 in the chimera MutY.
- Promoter tac
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer UpTac - GTTTTTTGCGCCGACATCATAACGGTTC
- 3′ sequencing primer TacTrm - GCTTCTGCGTTCTGATTTAATCTGTATCAGGCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EcNGsC-S308V-pKK223 was a gift from Martin Horvath (Addgene plasmid # 131393 ; http://n2t.net/addgene:131393 ; RRID:Addgene_131393) -
For your References section:
Structural Basis for Finding OG Lesions and Avoiding Undamaged G by the DNA Glycosylase MutY. Russelburg LP, O'Shea Murray VL, Demir M, Knutsen KR, Sehgal SL, Cao S, David SS, Horvath MP. ACS Chem Biol. 2019 Dec 27. doi: 10.1021/acschembio.9b00639. 10.1021/acschembio.9b00639 PubMed 31829624