pJW4.12
(Plasmid
#131374)
-
Purposeexpression of MBP:PPTR-1 in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMAL-c2X (MBP fusion)
-
Backbone manufacturerJason Pellettieri
- Backbone size w/o insert (bp) 8356
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepptr-1
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1631
-
Entrez Genepptr-1 (a.k.a. CELE_W08G11.4)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ggtcgtcagactgtcgatgaag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW4.12 was a gift from Geraldine Seydoux (Addgene plasmid # 131374 ; http://n2t.net/addgene:131374 ; RRID:Addgene_131374) -
For your References section:
Regulation of RNA granule dynamics by phosphorylation of serine-rich, intrinsically disordered proteins in C. elegans. Wang JT, Smith J, Chen BC, Schmidt H, Rasoloson D, Paix A, Lambrus BG, Calidas D, Betzig E, Seydoux G. Elife. 2014 Dec 23;4. doi: 10.7554/eLife.04591. 10.7554/eLife.04591 PubMed 25535836