pTSN7A
(Plasmid #131319)

• Purpose: Expressing synthetic TetR-GFP protein in N. crassa (from the his-3 locus)
• Depositing Lab: Eugene Gladyshev
• Publication: Nguyen et al Fungal Genet Biol. 2020 Mar;136:103316. doi: 10.1016/j.fgb.2019.103316. Epub 2019 Dec 9.

Backbone

• Vector backbone: pMF272
• Backbone size w/o insert (bp): 6805
• Total vector size (bp): 8576
• Vector type: Unspecified

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TetR-GFP
• Species: Synthetic
• Insert Size (bp): 1771
• Promoter: TrpC (from pCSN44)
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCCTAGATGATGGTTAGGCA
• 3′ sequencing primer: CGCCCTAATTAACCCTCACTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: EGFP is from pMF272; TetR is synthetic

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry