Skip to main content
Addgene

SECURE miniABEmax-K20A/R21A (pJUL1774)
(Plasmid #131312)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131312 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    CMV
  • Backbone size w/o insert (bp) 3399
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    bpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
  • Species
    E.coli, Streptococcus pyogenes
  • GenBank ID
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SECURE miniABEmax-K20A/R21A (pJUL1774) was a gift from Keith Joung (Addgene plasmid # 131312 ; http://n2t.net/addgene:131312 ; RRID:Addgene_131312)

  • For your References section:

    CRISPR DNA base editors with reduced RNA off-target and self-editing activities. Grunewald J, Zhou R, Iyer S, Lareau CA, Garcia SP, Aryee MJ, Joung JK. Nat Biotechnol. 2019 Sep 2. pii: 10.1038/s41587-019-0236-6. doi: 10.1038/s41587-019-0236-6. 10.1038/s41587-019-0236-6 PubMed 31477922
Related items:
Commonly requested with: