pCMV6-AN-HA_Ubiquitin
(Plasmid #131258)

• Purpose: Mammalian expression of ubiquitin with an N-terminal HA tag
• Depositing Lab: Roger Woodgate
• Publication: Ashton et al J Mol Biol. 2021 Jan 22;433(2):166733. doi: 10.1016/j.jmb.2020.166733. Epub 2020 Dec 3.

Backbone

• Vector backbone: pCMV6-AN-HA
• Backbone manufacturer: Origene
• Backbone size w/o insert (bp): 5926
• Total vector size (bp): 6163
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ubiquitin C
• Species: H. sapiens (human)
• Insert Size (bp): 273
• GenBank ID: NM_021009.7
• Entrez Gene: UBC (a.k.a. HMG20)
• Promoter: CMV enhancer + CMV promoter
• Tag / Fusion Protein:
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AsiSI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CAGGAAACAGCTATGAC

Resource Information

• Supplemental Documents:
  • pCMV6-AN-HA WT Ubiquitin.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry