Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-N-Myc_WT USP7
(Plasmid #131242)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131242 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1+/N-Myc
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 5435
  • Total vector size (bp) 8756
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ubiquitin carboxyl-terminal hydrolase 7
  • Alt name
    Ubiquitin-specific-processing protease 7
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3321
  • Entrez Gene
    USP7 (a.k.a. C16DELp13.2, DEL16P13.2, HAFOUS, HAUSP, TEF1)
  • Promoter CMV enhancer + CMV promoter
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-N-Myc_WT USP7 was a gift from Roger Woodgate (Addgene plasmid # 131242 ; http://n2t.net/addgene:131242 ; RRID:Addgene_131242)
  • For your References section:

    DNA Polymerase iota Interacts with Both the TRAF-like and UBL1-2 Domains of USP7. Ashton NW, Valles GJ, Jaiswal N, Bezsonova I, Woodgate R. J Mol Biol. 2021 Jan 22;433(2):166733. doi: 10.1016/j.jmb.2020.166733. Epub 2020 Dec 3. 10.1016/j.jmb.2020.166733 PubMed 33279577