pCMV6-AN-DDK_WT POLI
(Plasmid #131228)

• Purpose: Expression of WT DNA polymerase iota with an N-terminal FLAG tag in mammalian cells
• Depositing Lab: Roger Woodgate
• Publication: McIntyre et al Nucleic Acids Res. 2013 Feb 1;41(3):1649-60. doi: 10.1093/nar/gks1277. Epub 2012 Dec 16.

Backbone

• Vector backbone: pCMV6-AN-DDK
• Backbone manufacturer: Origene
• Backbone size w/o insert (bp): 5876
• Total vector size (bp): 8066
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DNA polymerase iota
• Alt name: POLI
• Alt name: DNA polymerase iota isoform a (short)
• Species: H. sapiens (human)
• Insert Size (bp): 2190
• Mutation: Coding sequence has been codon optimised for expression in human cells
• GenBank ID: NM_001351632.2
• Entrez Gene: POLI (a.k.a. RAD30B, RAD3OB, eta2)
• Promoter: CMV enhancer + CMV promoter
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AsiSI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CAGGAAACAGCTATGAC

Resource Information

• Supplemental Documents:
  • pCMV6-AN-DDK_WT POLI.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry