pSK247
(Plasmid #131148)

• Purpose: (Empty Backbone) dual yTRAP, Gateway destination vector of aTF2 fusion reporting on mNeonGreen
• Depositing Lab: Ahmad Khalil
• Publication: Newby et al Cell. 2017 Nov 2;171(4):966-979.e18. doi: 10.1016/j.cell.2017.09.041. Epub 2017 Oct 19.

Backbone

• Vector backbone: pGAN049
• Backbone manufacturer: Gregory Newby
• Backbone size (bp): 10365
• Modifications to backbone: replaced aTF 43-8 and its binding sites with aTF 37-12 and its binding sites
• Vector type: Yeast Expression
• Promoter: pSUP35, min pCYC1
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): ccdB Survival
• Growth instructions: TG1 strain
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgtttacaatttcctgatgcggt
• 3′ sequencing primer: atgatcggtattattgtgtttgca

Resource Information

• Supplemental Documents:
  • pSK247_KanMX_LEU2_pSup35-37-12-VP16-fusion 8x37-12-pCYC1-Neon_pDEST.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is one of the empty dual yTRAP sensor plasmids. To sense aggregation of your favorite protein, clone the coding sequence into a pENTR clone, then perform LR reaction with pSK247. The resulting expression clone should be linearized with NotI-HF enzyme prior to integration into the yeast genome. The sensor integrates into the LEU2 locus, and can be selected for using 100 ug/ml G418. It can be used in combination with pSK260.