pTIGER_mNeonGreen::3xFLAG::dCrk
(Plasmid #131137)

• Purpose: UASp construct for over-expression of Drosophila Crk with N-terminal monomeric NeonGreen and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.
• Depositing Lab: Mark Peifer
• Publication: Spracklen et al Mol Biol Cell. 2019 Jul 18:mbcE19050302. doi: 10.1091/mbc.E19-05-0302.

Backbone

• Vector backbone: pTIGER
• Backbone size w/o insert (bp): 10240
• Total vector size (bp): 11733
• Vector type: Insect Expression
• Selectable markers: mini-White

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Crk
• Species: D. melanogaster (fly)
• Insert Size (bp): 1597
• Entrez Gene: Crk (a.k.a. Dmel_CG1587, CG1587, CRK, D-CRK, D-Crk, DCrk, Dcrk, Dmel\CG1587, crk, dCRK, dCrk)
• Tags / Fusion Proteins:
  • mNeonGreen (N terminal on insert)
  • 3XFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: Sph1 (unknown if destroyed)
• 5′ sequencing primer: TTTGAAAACCGGTGATAGAGC
• 3′ sequencing primer: AACTGAGTTTCTTCGAAATTGG

Resource Information

• Supplemental Documents:
  • pTIGER_mNeonGreen--3XFLAG--dCrk.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry