pYJ34-PB-CRISPR-BANCR-E1-gRNA
(Plasmid
#131077)
-
Purposelong non-coding RNA BANCR knock out
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB-CRISPR
- Backbone size w/o insert (bp) 11659
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBANCR Exon1 gRNA
-
gRNA/shRNA sequenceGAAATAGACTGCAGCACCAA
-
SpeciesH. sapiens (human)
-
Entrez GeneBANCR (a.k.a. LINC00586)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYJ34-PB-CRISPR-BANCR-E1-gRNA was a gift from Xiaojun Lian (Addgene plasmid # 131077 ; http://n2t.net/addgene:131077 ; RRID:Addgene_131077) -
For your References section:
Robust genome and RNA editing via CRISPR nucleases in PiggyBac systems. Jiang Y, Hoenisch RC, Chang Y, Bao X, Cameron CE, Lian XL. Bioact Mater. 2022 Feb 7;14:313-320. doi: 10.1016/j.bioactmat.2022.01.046. eCollection 2022 Aug. 10.1016/j.bioactmat.2022.01.046 PubMed 35386818