K8.1Pr-pGL4.16
(Plasmid
#131037)
-
PurposeFirefly Luciferase reporter for K8.1 promoter from KSHV
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL4.16
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6050
- Total vector size (bp) 6075
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKSHV K8.1 100 bp promoter
-
SpeciesKaposi's Sarcoma Herpesvirus
-
Insert Size (bp)100
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GTACTAACATACGCTCTCCATC
- 3′ sequencing primer GCGTAGCGCTTCATGGCTTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K8.1Pr-pGL4.16 was a gift from Britt Glaunsinger (Addgene plasmid # 131037 ; http://n2t.net/addgene:131037 ; RRID:Addgene_131037) -
For your References section:
An integrative approach identifies direct targets of the late viral transcription complex and an expanded promoter recognition motif in Kaposi's sarcoma-associated herpesvirus. Nandakumar D, Glaunsinger B. PLoS Pathog. 2019 May 16;15(5):e1007774. doi: 10.1371/journal.ppat.1007774. eCollection 2019 May. 10.1371/journal.ppat.1007774 PubMed 31095645