Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

K8.1Pr-pGL4.16
(Plasmid #131037)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131037 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL4.16
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6050
  • Total vector size (bp) 6075
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KSHV K8.1 100 bp promoter
  • Species
    Kaposi's Sarcoma Herpesvirus
  • Insert Size (bp)
    100

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GTACTAACATACGCTCTCCATC
  • 3′ sequencing primer GCGTAGCGCTTCATGGCTTTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K8.1Pr-pGL4.16 was a gift from Britt Glaunsinger (Addgene plasmid # 131037 ; http://n2t.net/addgene:131037 ; RRID:Addgene_131037)
  • For your References section:

    An integrative approach identifies direct targets of the late viral transcription complex and an expanded promoter recognition motif in Kaposi's sarcoma-associated herpesvirus. Nandakumar D, Glaunsinger B. PLoS Pathog. 2019 May 16;15(5):e1007774. doi: 10.1371/journal.ppat.1007774. eCollection 2019 May. 10.1371/journal.ppat.1007774 PubMed 31095645