pGALSc104b Y257W
(Plasmid
#1310)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 1310 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGAL
- Backbone size w/o insert (bp) 5586
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHsp104 Y257W
-
Alt nameHsp104
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2850
-
MutationChanged Tyr 257 to Trp
-
Entrez GeneHSP104 (a.k.a. YLL026W)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer TTGTTAATATACCTCTATACT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGALSc104b Y257W was a gift from Susan Lindquist (Addgene plasmid # 1310 ; http://n2t.net/addgene:1310 ; RRID:Addgene_1310) -
For your References section:
Defining a pathway of communication from the C-terminal peptide binding domain to the N-terminal ATPase domain in a AAA protein. Cashikar AG, Schirmer EC, Hattendorf DA, Glover JR, Ramakrishnan MS, Ware DM, Lindquist SL. Mol Cell 2002 Apr;9(4):751-60. 10.1016/S1097-2765(02)00499-9 PubMed 11983167