Skip to main content
Addgene

PX458-3xHA-FnCas9
(Plasmid #130969)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130969 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    PX458
  • Backbone size w/o insert (bp) 5023
  • Total vector size (bp) 10091
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FnCas9
  • Alt name
    FnCas9b
  • Species
    Synthetic; Francisella tularensis subsp. novicida
  • Insert Size (bp)
    5068
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3xHA-NLS (N terminal on insert)
    • NLS-T2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer CBA Forward 5' CTCCGGGCTGTAATTAGCTG 3'
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FnCas9 gene was subcloned from PX408, a gift from Feng Zhang

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-3xHA-FnCas9 was a gift from Debojyoti Chakraborty (Addgene plasmid # 130969 ; http://n2t.net/addgene:130969 ; RRID:Addgene_130969)

  • For your References section:

    Francisella novicida Cas9 interrogates genomic DNA with very high specificity and can be used for mammalian genome editing. Acharya S, Mishra A, Paul D, Ansari AH, Azhar M, Kumar M, Rauthan R, Sharma N, Aich M, Sinha D, Sharma S, Jain S, Ray A, Jain S, Ramalingam S, Maiti S, Chakraborty D. Proc Natl Acad Sci U S A. 2019 Oct 15;116(42):20959-20968. doi: 10.1073/pnas.1818461116. Epub 2019 Sep 30. 10.1073/pnas.1818461116 PubMed 31570623
Related items:
Commonly requested with: