pRRL-gRNA(anti-cGAS)-Cas9-Puro
(Plasmid
#130908)
-
PurposegRNA targeting human cGAS; Cas9 insert; Puromycin selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130908 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRL
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AACGGATCTCGACGGTATCGG
- 3′ sequencing primer AACTTGCTATTTCTAGCTCTAAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL-gRNA(anti-cGAS)-Cas9-Puro was a gift from Jonathan Kagan (Addgene plasmid # 130908 ; http://n2t.net/addgene:130908 ; RRID:Addgene_130908) -
For your References section:
Phosphoinositide Interactions Position cGAS at the Plasma Membrane to Ensure Efficient Distinction between Self- and Viral DNA. Barnett KC, Coronas-Serna JM, Zhou W, Ernandes MJ, Cao A, Kranzusch PJ, Kagan JC. Cell. 2019 Mar 7;176(6):1432-1446.e11. doi: 10.1016/j.cell.2019.01.049. Epub 2019 Feb 28. 10.1016/j.cell.2019.01.049 PubMed 30827685