Skip to main content
Addgene

pCMV-Sport6-CD63-pHuji
(Plasmid #130902)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130902 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV-Sport6
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4360
  • Total vector size (bp) 5797
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD63-pHuji
  • Species
    H. sapiens (human); synthetic
  • Insert Size (bp)
    1437
  • Mutation
    pHuji inserted between Gln-36 and Leu-37 in extracellular loop 1
  • Entrez Gene
    CD63 (a.k.a. AD1, HOP-26, ME491, MLA1, OMA81H, Pltgp40, TSPAN30)
  • Promoter CMV
  • Tag / Fusion Protein
    • pHuji

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GAGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer AATACGACTCACTATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Sport6-CD63-pHuji was a gift from DM Pegtel (Addgene plasmid # 130902 ; http://n2t.net/addgene:130902 ; RRID:Addgene_130902)
  • For your References section:

    Quantifying exosome secretion from single cells reveals a modulatory role for GPCR signaling. Verweij FJ, Bebelman MP, Jimenez CR, Garcia-Vallejo JJ, Janssen H, Neefjes J, Knol JC, de Goeij-de Haas R, Piersma SR, Baglio SR, Verhage M, Middeldorp JM, Zomer A, van Rheenen J, Coppolino MG, Hurbain I, Raposo G, Smit MJ, Toonen RFG, van Niel G, Pegtel DM. J Cell Biol. 2018 Mar 5;217(3):1129-1142. doi: 10.1083/jcb.201703206. Epub 2018 Jan 16. 10.1083/jcb.201703206 PubMed 29339438