pAAV-hSyn-DIO-jGCamp7b-P2A-GSG-mRuby3
(Plasmid
#130900)
-
Purposebicistronic plasmid for dual-color neuronal calcium and morphology imaging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130900 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4222
- Total vector size (bp) 6960
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namejGCaMP7b-P2A-mRuby3
-
SpeciesSynthetic
-
Insert Size (bp)2738
-
GenBank IDATE88097 QCW12733
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TGTCGTGCCTGAGAGCGCAGTC
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO-jGCamp7b-P2A-GSG-mRuby3 was a gift from Simon Wiegert (Addgene plasmid # 130900 ; http://n2t.net/addgene:130900 ; RRID:Addgene_130900)