Skip to main content
Addgene

mDlx-SynTagMA_post-2A-mCerulean
(Plasmid #130899)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130899 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 3868
  • Total vector size (bp) 7633
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SynTagMA
  • Species
    Synthetic
  • Promoter mDlx
  • Tag / Fusion Protein
    • mCerulean (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site blunt (unknown if destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer TATACACTCACAGTGGTTTGGC
  • 3′ sequencing primer TTACTTGTACAGCTCGTCCATG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mDlx-SynTagMA_post-2A-mCerulean was a gift from Simon Wiegert (Addgene plasmid # 130899 ; http://n2t.net/addgene:130899 ; RRID:Addgene_130899)

  • For your References section:

    Freeze-frame imaging of synaptic activity using SynTagMA. Perez-Alvarez A, Fearey BC, O'Toole RJ, Yang W, Arganda-Carreras I, Lamothe-Molina PJ, Moeyaert B, Mohr MA, Panzera LC, Schulze C, Schreiter ER, Wiegert JS, Gee CE, Hoppa MB, Oertner TG. Nat Commun. 2020 May 18;11(1):2464. doi: 10.1038/s41467-020-16315-4. 10.1038/s41467-020-16315-4 PubMed 32424147
Related items:
Commonly requested with: