Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFl Strep-Sumo-TEV human OAS1
(Plasmid #130895)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130895 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFl
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    oligoadenylate synthase 1
  • Alt name
    OAS1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1632
  • Entrez Gene
    OAS1 (a.k.a. E18/E16, IFI-4, IMD100, OIAS, OIASI)
  • Promoter ph
  • Tag / Fusion Protein
    • Strep_Sumo (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTATAAATATTCCGGATTATTC
  • 3′ sequencing primer CTACAAATGTGGTATGGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFl Strep-Sumo-TEV human OAS1 was a gift from Leemor Joshua-Tor (Addgene plasmid # 130895 ; http://n2t.net/addgene:130895 ; RRID:Addgene_130895)
  • For your References section:

    ELTA: Enzymatic Labeling of Terminal ADP-Ribose. Ando Y, Elkayam E, McPherson RL, Dasovich M, Cheng SJ, Voorneveld J, Filippov DV, Ong SE, Joshua-Tor L, Leung AKL. Mol Cell. 2019 Feb 21;73(4):845-856.e5. doi: 10.1016/j.molcel.2018.12.022. Epub 2019 Jan 31. 10.1016/j.molcel.2018.12.022 PubMed 30712989