Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MLKP1delTM
(Plasmid #130841)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130841 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pH7WG2
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MLKP1
  • Species
    Zea mays (maize)
  • Mutation
    Deletion of transmembrane domain
  • Promoter CaMV 35S
  • Tag / Fusion Protein
    • eGFP-FLAG-HA (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGTCTCCAAGGGGGAGG
  • 3′ sequencing primer TGCGGACTCTAGCATGGCCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MLKP1delTM was a gift from Hank Bass (Addgene plasmid # 130841 ; http://n2t.net/addgene:130841 ; RRID:Addgene_130841)
  • For your References section:

    Identification and characterization of genes encoding the nuclear envelope LINC complex in the monocot species Zea mays. Gumber HK, McKenna JF, Estrada AL, Tolmie AF, Graumann K, Bass HW. J Cell Sci. 2019 Feb 11;132(3). pii: jcs.221390. doi: 10.1242/jcs.221390. 10.1242/jcs.221390 PubMed 30659121