pAG472 H2B-iFAST
(Plasmid
#130818)
-
PurposeExpresses H2B-iFAST in mammalian cells (nuclear labeling)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 3966
- Total vector size (bp) 4785
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-iFAST
-
Alt nameH2B-FAST2
-
Alt nameiFAST fused to zebrafish H2B
-
Alt nameFAST2 fused to zebrafish H2B
-
Insert Size (bp)819
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG472 H2B-iFAST was a gift from Arnaud Gautier (Addgene plasmid # 130818 ; http://n2t.net/addgene:130818 ; RRID:Addgene_130818)