pAG106 Lyn11-FAST
(Plasmid
#130721)
-
PurposeExpresses FAST (also called YFAST) fused to Lyn11 sequence in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 3999
- Total vector size (bp) 4419
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelyn11-FAST
-
Alt namelyn11-YFAST, lyn11-FAST1
-
SpeciesSynthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG106 Lyn11-FAST was a gift from Arnaud Gautier (Addgene plasmid # 130721 ; http://n2t.net/addgene:130721 ; RRID:Addgene_130721) -
For your References section:
Small fluorescence-activating and absorption-shifting tag for tunable protein imaging in vivo. Plamont MA, Billon-Denis E, Maurin S, Gauron C, Pimenta FM, Specht CG, Shi J, Querard J, Pan B, Rossignol J, Moncoq K, Morellet N, Volovitch M, Lescop E, Chen Y, Triller A, Vriz S, Le Saux T, Jullien L, Gautier A. Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):497-502. doi: 10.1073/pnas.1513094113. Epub 2015 Dec 28. 10.1073/pnas.1513094113 PubMed 26711992