-
PurposeExpresses His-tagged FAST (also called YFAST) in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5329
- Total vector size (bp) 5701
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFAST
-
Alt nameYFAST, FAST1
-
Alt namefluorescence-activating and absorption-shifting tag
-
SpeciesSynthetic
-
Insert Size (bp)372
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG87 FAST was a gift from Arnaud Gautier (Addgene plasmid # 130719 ; http://n2t.net/addgene:130719 ; RRID:Addgene_130719) -
For your References section:
Small fluorescence-activating and absorption-shifting tag for tunable protein imaging in vivo. Plamont MA, Billon-Denis E, Maurin S, Gauron C, Pimenta FM, Specht CG, Shi J, Querard J, Pan B, Rossignol J, Moncoq K, Morellet N, Volovitch M, Lescop E, Chen Y, Triller A, Vriz S, Le Saux T, Jullien L, Gautier A. Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):497-502. doi: 10.1073/pnas.1513094113. Epub 2015 Dec 28. 10.1073/pnas.1513094113 PubMed 26711992