pWZL-Stat5a1*6
(Plasmid #130669)

• Purpose: Retroviral vector for the expression of constitutive Stat5a (hygromycin resistance)
• Depositing Lab: Gerardo Ferbeyre
• Publication: Mallette et al J Biol Chem. 2007 Nov 30;282(48):34938-44. doi: 10.1074/jbc.M707074200. Epub 2007 Oct 3.

Backbone

• Vector backbone: pWZL
• Backbone size w/o insert (bp): 5725
• Total vector size (bp): 8215
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Stat5a
• Species: M. musculus (mouse)
• Insert Size (bp): 2382
• Mutation: changed Histidine 298 to Arginine and Serine 710 to Phenylalanine
• GenBank ID: NM_011488
• Entrez Gene: Stat5a (a.k.a. STAT5)
• Promoter: LTR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: atcgtgacctgggaagccttg
• 3′ sequencing primer: aatgctcgtcaagaagac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: subcloned from pMXSTAT5A1*6: Onishi, M., Nosaka, T., Misawa, K., Mui, A. L., Gorman, D., McMahon, M., Miyajima, A., and Kitamura, T. (1998) Mol Cell Biol 18, 3871-3879

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry