15x-QUAS-dTomato-T2A-GCaMP6s
(Plasmid
#130666)
-
PurposeQUAS reporter line that expresses cytosolic dTomato and the GCaMP6s calcium indicator, separated by T2A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130666 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAddgene 104875, pBac-ECFP-15xQUAS_TATA-SV40
- Total vector size (bp) 8747
-
Vector typeInsect Expression ; Ae. aegypti expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name15xQUAS-dTomato-T2A-GCaMP6s
-
Insert Size (bp)3469
- Promoter 15xQUAS-TATA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCCAGGGTTTTCCCAGTCACGACG
- 3′ sequencing primer GTCATAGCTGTTTCCTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBackbone is a gift from Chris Potter, Addgene #104875
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
15x-QUAS-dTomato-T2A-GCaMP6s was a gift from Leslie Vosshall (Addgene plasmid # 130666 ; http://n2t.net/addgene:130666 ; RRID:Addgene_130666) -
For your References section:
The ion channel ppk301 controls freshwater egg-laying in the mosquito Aedes aegypti. Matthews BJ, Younger MA, Vosshall LB. eLife. 2019 May 21;8. pii: 43963. doi: 10.7554/eLife.43963. 10.7554/eLife.43963 PubMed 31112133