pTK_Cerulean_Nanotag_91_positive_Control
(Plasmid
#130572)
-
PurposeEnhancer cloning nanotag reporter vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTK_BsmBI
- Backbone size w/o insert (bp) 4670
-
Vector typeEnhancer cloning nanotag reporter vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFoxD3_cranial_neural_crest_enhancer_NC3
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)550
- Promoter thymidine kinase minimal promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer pTK forward CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer pTK reverse ATATTTCTTCCGGGGACACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK_Cerulean_Nanotag_91_positive_Control was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 130572 ; http://n2t.net/addgene:130572 ; RRID:Addgene_130572) -
For your References section:
Reconstruction of the Global Neural Crest Gene Regulatory Network In Vivo. Williams RM, Candido-Ferreira I, Repapi E, Gavriouchkina D, Senanayake U, Ling ITC, Telenius J, Taylor S, Hughes J, Sauka-Spengler T. Dev Cell. 2019 Oct 21;51(2):255-276.e7. doi: 10.1016/j.devcel.2019.10.003. 10.1016/j.devcel.2019.10.003 PubMed 31639368