Skip to main content
Addgene

pAAV_Donor/Reporter-COL4A3
(Plasmid #130279)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130279 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV2.1
  • Backbone size w/o insert (bp) 5419
  • Total vector size (bp) 6948
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-eGFP
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cgtggatagcggtttgactc
  • 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_Donor/Reporter-COL4A3 was a gift from Silvestro Conticello (Addgene plasmid # 130279 ; http://n2t.net/addgene:130279 ; RRID:Addgene_130279)
  • For your References section:

    New frontiers to cure Alport syndrome: COL4A3 and COL4A5 gene editing in podocyte-lineage cells. Daga S, Donati F, Capitani K, Croci S, Tita R, Giliberti A, Valentino F, Benetti E, Fallerini C, Niccheri F, Baldassarri M, Mencarelli MA, Frullanti E, Furini S, Conticello SG, Renieri A, Pinto AM. Eur J Hum Genet. 2019 Nov 21. pii: 10.1038/s41431-019-0537-8. doi: 10.1038/s41431-019-0537-8. 10.1038/s41431-019-0537-8 PubMed 31754267