pcDNA3-Myd88-CFP
(Plasmid #13026)

• Depositing Lab: Doug Golenbock
• Publication: TLR Signaling Plasmids (unpublished)

Backbone

• Vector backbone: pcDNA3-CFP
• Backbone size w/o insert (bp): 6160
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: myeloid differentiation primary response gene (88)
• Alt name: MyD88
• Species: H. sapiens (human)
• Insert Size (bp): 888
• GenBank ID: NM_002468
• Entrez Gene: MYD88 (a.k.a. IMD68, MYD88D, WM1)
• Tag / Fusion Protein:
  • CFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI / XhoI (destroyed during cloning)
• 5′ sequencing primer: T7
• 3′ sequencing primer: GTCTTGTAGTTGCCGTCGTC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

Please note that the MyD88 insert in this plasmid does not express full-length MyD88 relative to GenBank reference NP_002459.2. This was an intentional result of the cloning strategy employed in constructing this vector. For more information, please see the following publication: https://www.ncbi.nlm.nih.gov/pubmed/12324469