Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ORF18(L151A)-3xFLAG pCDNA4
(Plasmid #129799)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129799 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone size w/o insert (bp) 5168
  • Total vector size (bp) 5928
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORF18
  • Species
    Kaposi's sarcoma-associated herpesvirus (HHV-8)
  • Insert Size (bp)
    771
  • Mutation
    changed Leucine 151 to Alanine
  • Entrez Gene
    ORF18 (a.k.a. HHV8GK18_gp22)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ORF18(L151A)-3xFLAG pCDNA4 was a gift from Britt Glaunsinger (Addgene plasmid # 129799 ; http://n2t.net/addgene:129799 ; RRID:Addgene_129799)
  • For your References section:

    The interaction between ORF18 and ORF30 is required for late gene expression in Kaposi's sarcoma-associated herpesvirus. Castaneda AF, Glaunsinger BA. J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18. 10.1128/JVI.01488-18 PubMed 30305361