pT3-EF1A-MYC-IRES-luc
(Plasmid #129775)

• Purpose: Transposon based vector that expresses human MYC followed by IRES and firefly luciferase
• Depositing Lab: Amaia Lujambio
• Publication: Ruiz de Galarreta et al Cancer Discov. 2019 Jun 11. pii: 2159-8290.CD-19-0074. doi: 10.1158/2159-8290.CD-19-0074.

Backbone

• Vector backbone: pT3-EF1a
• Total vector size (bp): 9144
• Modifications to backbone: Insertion of human MYC, IRES, and firefly luciferase
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Slow growing plasmids, grow at least 18 hours.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: human MYC
• Alt name: MYC
• Species: H. sapiens (human)
• Insert Size (bp): 3700
• Entrez Gene: MYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
• Promoter: EF1A
• Tag / Fusion Protein:
  • luciferase (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Xin Chen (backbone vector)
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid contains loxp sites so it´s not ideal for experiments in mice expressing Cre.