Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCZGY1584 Pcol-19::ebp-2::mGFP::unc-54 3'UTR
(Plasmid #129774)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129774 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDEST
  • Backbone manufacturer
    Invitrogen Gateway
  • Backbone size w/o insert (bp) 2500
  • Total vector size (bp) 5985
  • Vector type
    Worm Expression, Synthetic Biology ; Gateway

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Pcol-19
  • Alt name
    col-19p
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    665
  • Promoter Pcol-19
  • Tag / Fusion Protein
    • Synthetic Intron (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer CAGGAAACAGCTATGACCATG
  • 3′ sequencing primer ttgatgaactgatgtctttc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ebp-2
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1100
  • GenBank ID
    CELE_VW02B12L.3
  • Entrez Gene
    ebp-2 (a.k.a. CELE_VW02B12L.3)
  • Tag / Fusion Protein
    • mGFP (C terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCAAAGGACCCAAAGGTATG
  • 3′ sequencing primer CTGAACTTGTGGCCGTTTAC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    unc-54 3'UTR
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    735

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer TCGGCATGGACGAGCTGTAC
  • 3′ sequencing primer TGCCGCATAGTTAAGCCAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Made by Suhong Xu in the Chisholm Lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: The plasmid region containing col-19 promoter and 5' synthetic intron are in the opposite orientation in the plasmid compared to the depositor's sequence. This is not known to be a concern for plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY1584 Pcol-19::ebp-2::mGFP::unc-54 3'UTR was a gift from Andrew Chisholm (Addgene plasmid # 129774 ; http://n2t.net/addgene:129774 ; RRID:Addgene_129774)
  • For your References section:

    DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair. Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD. Elife. 2016 Sep 23;5. doi: 10.7554/eLife.15833. 10.7554/eLife.15833 PubMed 27661253