pCZGY1584 Pcol-19::ebp-2::mGFP::unc-54 3'UTR
(Plasmid #129774)

• Purpose: Marker of microtubule dynamics in C. elegans hypodermis
• Depositing Lab: Andrew Chisholm
• Publication: Chuang et al Elife. 2016 Sep 23;5. doi: 10.7554/eLife.15833.

Backbone

• Vector backbone: pDEST
• Backbone manufacturer: Invitrogen Gateway
• Backbone size w/o insert (bp): 2500
• Total vector size (bp): 5985
• Vector type: Worm Expression, Synthetic Biology ; Gateway

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Pcol-19
• Alt name: col-19p
• Species: C. elegans (nematode)
• Insert Size (bp): 665
• Promoter: Pcol-19
• Tag / Fusion Protein:
  • Synthetic Intron (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: CAGGAAACAGCTATGACCATG
• 3′ sequencing primer: ttgatgaactgatgtctttc

Gene/Insert 2

• Gene/Insert name: ebp-2
• Species: C. elegans (nematode)
• Insert Size (bp): 1100
• GenBank ID: CELE_VW02B12L.3
• Entrez Gene: ebp-2 (a.k.a. CELE_VW02B12L.3)
• Tag / Fusion Protein:
  • mGFP (C terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CCAAAGGACCCAAAGGTATG
• 3′ sequencing primer: CTGAACTTGTGGCCGTTTAC

Gene/Insert 3

• Gene/Insert name: unc-54 3'UTR
• Species: C. elegans (nematode)
• Insert Size (bp): 735

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: TCGGCATGGACGAGCTGTAC
• 3′ sequencing primer: TGCCGCATAGTTAAGCCAGC

Resource Information

• Supplemental Documents:
  • pSX142 pcol-19-ebp-2-mGFP.str
• A portion of this plasmid was derived from a plasmid made by: Made by Suhong Xu in the Chisholm Lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: The plasmid region containing col-19 promoter and 5' synthetic intron are in the opposite orientation in the plasmid compared to the depositor's sequence. This is not known to be a concern for plasmid function.