pLVX-TetOneZeo-ORF18(E36A_L37A)-3xFLAG
(Plasmid #129758)

• Purpose: Dox inducible expression of KSHV ORF18-3xFLAG (E36A_L37A) in mammalian cells
• Depositing Lab: Britt Glaunsinger
• Publication: Castaneda et al J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18.

Backbone

• Vector backbone: pLVX
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 9002
• Total vector size (bp): 9874
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ORF18
• Species: Kaposi's sarcoma-associated herpesvirus (HHV-8)
• Insert Size (bp): 882
• Mutation: changed Glutamic acid 36 to Alanine and Leucine 37 to Alanine
• Entrez Gene: ORF18 (a.k.a. HHV8GK18_gp22)
• Promoter: TRE3Gs
• Tag / Fusion Protein:
  • 3xFLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: BamHI (destroyed during cloning)
• 5′ sequencing primer: gggcgcctataaaagagtgctg
• 3′ sequencing primer: ctctgacggccctcctgt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry