Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTW5126
(Plasmid #129732)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129732 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD/myc-HisB
  • Backbone manufacturer
    ThermoFisher Scientific
  • Backbone size w/o insert (bp) 4047
  • Total vector size (bp) 7943
  • Modifications to backbone
    none
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eatA-DUF::His8
  • Species
    Escherichia coli, Enterotoxigenic
  • Insert Size (bp)
    3897
  • Mutation
    replaces the domain of unknown function corresponding to amino acids E541 -Q617 of the native EatA protein with 8H followed by an in-frame XhoI induced scar of L549-E550 in the DUF deletion recombinant.
  • GenBank ID
    AY163491.2
  • Promoter araBAD
  • Tag / Fusion Protein
    • 9His tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGTGCTTTGGCAGGTTAAT
  • 3′ sequencing primer none
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plate note: Plasmid contains V673A and E1051G mutations in eatA-DUF. These mutations are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTW5126 was a gift from James Fleckenstein (Addgene plasmid # 129732 ; http://n2t.net/addgene:129732 ; RRID:Addgene_129732)
  • For your References section:

    Enterotoxigenic Escherichia coli degrades the host MUC2 mucin barrier to facilitate critical pathogen-enterocyte interactions in human small intestine. Sheikh A, Wangdi T, Vickers TJ, Aaron B, Palmer M, Miller MJ, Kim S, Herring C, Simoes R, Crainic JA, Gildersleeve JC, van der Post S, Hansson GC, Fleckenstein JM. Infect Immun. 2021 Nov 22:IAI0057221. doi: 10.1128/IAI.00572-21. 10.1128/IAI.00572-21 PubMed 34807735