Skip to main content
Addgene

pSH-EFIRES-B-AtAFB2-mCherry
(Plasmid #129718)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129718 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSH-EFIRES-B
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 10442
  • Vector type
    Mammalian Expression, CRISPR, TALEN ; Human safe harbor locus (A AVS1) site-specific integration
  • Selectable markers
    Blasticidin ; mCherry for FACS enrichment

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AFB2
  • Alt name
    auxin signaling F-box 2
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2445
  • Mutation
    codon optimized
  • Entrez Gene
    AFB2 (a.k.a. AT3G26810, auxin signaling F-box 2)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer tctctccacaggtgtccact
  • 3′ sequencing primer acaccggccttattccaagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH-EFIRES-B-AtAFB2-mCherry was a gift from Elina Ikonen (Addgene plasmid # 129718 ; http://n2t.net/addgene:129718 ; RRID:Addgene_129718)
  • For your References section:

    An efficient auxin-inducible degron system with low basal degradation in human cells. Li S, Prasanna X, Salo VT, Vattulainen I, Ikonen E. Nat Methods. 2019 Aug 26. pii: 10.1038/s41592-019-0512-x. doi: 10.1038/s41592-019-0512-x. 10.1038/s41592-019-0512-x PubMed 31451765