pSH-EFIRES-P-AtAFB2-mCherry-weak NLS
(Plasmid #129717)

• Purpose: AAVS1 safe harbor targeting vector expressing AtAFB2-mCherry-weak NLS
• Depositing Lab: Elina Ikonen
• Publication: Li et al Nat Methods. 2019 Aug 26. pii: 10.1038/s41592-019-0512-x. doi: 10.1038/s41592-019-0512-x.

Backbone

• Vector backbone: pSH-EFIRES-P
• Backbone size w/o insert (bp): 8200
• Total vector size (bp): 10698
• Vector type: Mammalian Expression, CRISPR, TALEN ; Human safe harbor locus (A AVS1) site-specific integration
• Selectable markers: Puromycin ; mCherry for FACS enrichment

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AFB2
• Alt name: auxin signaling F-box 2
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2472
• Mutation: codon optimized
• Entrez Gene: AFB2 (a.k.a. AT3G26810, auxin signaling F-box 2)
• Promoter: EF1a
• Tag / Fusion Protein:
  • mCherry-weak NLS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: tctctccacaggtgtccact
• 3′ sequencing primer: acaccggccttattccaagc

Resource Information

• Supplemental Documents:
  • pSH-EFIRES-P-AtAFB2-mCherry-weak NLS ED5L4.2-2.gb
• A portion of this plasmid was derived from a plasmid made by: AtAFB2 codon-optimized and synthesized by Genscript.
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry