AAV-phsyn-FLEX-KASH-EGFP-U6-shRNA
(Plasmid
#129708)
-
PurposeExpress cre-dependent KASH-EGFP and scramble shRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV-phsyn-FLEX-EGFP
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKASH-EGFP
-
gRNA/shRNA sequenceggaagagcgagctcttct
- Promoter U6
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer gactatcatatgcttaccgt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-phsyn-FLEX-KASH-EGFP-U6-shRNA was a gift from Yi Zhang (Addgene plasmid # 129708 ; http://n2t.net/addgene:129708 ; RRID:Addgene_129708) -
For your References section:
In vivo nuclear capture and molecular profiling identifies Gmeb1 as a transcriptional regulator essential for dopamine neuron function. Tuesta LM, Djekidel MN, Chen R, Lu F, Wang W, Sabatini BL, Zhang Y. Nat Commun. 2019 Jun 7;10(1):2508. doi: 10.1038/s41467-019-10267-0. 10.1038/s41467-019-10267-0 PubMed 31175277