Skip to main content
Addgene

AAV-pEF1a-FLEX-HA-VHH-KASH-WPRE
(Plasmid #129704)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129704 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV-pEF1a-FLEX-WPRE
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HA-VHH-KASH
  • Insert Size (bp)
    663
  • Promoter EF1a
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CAAGCCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer CACAAATTTTGTAATCCAGAGGTTG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains SFEF141-144GAAG change in the linker region of the GFP nanobody-KASH insert. These differences are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-pEF1a-FLEX-HA-VHH-KASH-WPRE was a gift from Yi Zhang (Addgene plasmid # 129704 ; http://n2t.net/addgene:129704 ; RRID:Addgene_129704)

  • For your References section:

    In vivo nuclear capture and molecular profiling identifies Gmeb1 as a transcriptional regulator essential for dopamine neuron function. Tuesta LM, Djekidel MN, Chen R, Lu F, Wang W, Sabatini BL, Zhang Y. Nat Commun. 2019 Jun 7;10(1):2508. doi: 10.1038/s41467-019-10267-0. 10.1038/s41467-019-10267-0 PubMed 31175277
Related items:
Commonly requested with: