-
PurposeExpresses Ace-7aa-mScarlet in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLV
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 10703
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAce-7aa-mScarlet
-
Insert Size (bp)1500
- Promoter Camk2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTCAAGCCGGTTCTCCGTTTGCACTC
- 3′ sequencing primer CAGCGTATCCACATAGCGTAAAAGGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LV-Camk2-Ace-7aa-mScarlet was a gift from Yiyang Gong (Addgene plasmid # 129701 ; http://n2t.net/addgene:129701 ; RRID:Addgene_129701) -
For your References section:
A high-speed, bright, red fluorescent voltage sensor to detect neural activity. Beck C, Gong Y. Sci Rep. 2019 Nov 4;9(1):15878. doi: 10.1038/s41598-019-52370-8. 10.1038/s41598-019-52370-8 PubMed 31685893