NmMetQ WT
(Plasmid #129647)

• Purpose: Expresses the mature metQ gene from Neisseria meningitides, without the signal sequence
• Depositing Lab: Douglas Rees
• Publication: Nguyen et al Protein Sci. 2019 Jul 26. doi: 10.1002/pro.3694.

Backbone

• Vector backbone: pET21b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5474
• Total vector size (bp): 6222
• Modifications to backbone: Removed the 6x His Tag + Stop Codon (caccaccaccaccaccactga) at C Terminal end of the insert
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: metQ Gene
• Alt name: Methionine Substrate Binding Protein
• Species: Neisseria meningitidis
• Insert Size (bp): 741
• GenBank ID: CP020421.2
• Promoter: T7 Promoter
• Tags / Fusion Proteins:
  • 10x Histidine Tag (N terminal on insert)
  • Enterokinase (N terminal on insert)
  • pelB signal sequence (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T7 Forward
• 3′ sequencing primer: T7 Reverse

Resource Information

• Supplemental Documents:
  • nmmetq-WT-with-pelb-s-s-in-pet21b.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry