pET20b-YbAnbu
(Plasmid
#129637)
-
PurposeExpression plasmid of Anbu from Y. bercovieri (UNIPROT A0A0T9RXH3 variant with V14A and G107H mutations)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET20b
-
Backbone manufacturerNovagene
- Backbone size w/o insert (bp) 3716
- Total vector size (bp) 4322
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor expression in BL21(DE3) no IPTG induction required
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYbAnbu
-
SpeciesYersinia bercovieri
-
Insert Size (bp)735
-
MutationV14A and G107H
-
GenBank IDCNF23894.1 CNI95872.1
- Promoter T7
-
Tag
/ Fusion Protein
- His6-tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET20b-YbAnbu was a gift from Matthias Bochtler (Addgene plasmid # 129637 ; http://n2t.net/addgene:129637 ; RRID:Addgene_129637) -
For your References section:
The Y. bercovieri Anbu crystal structure sheds light on the evolution of highly (pseudo)symmetric multimers. Piasecka A, Czapinska H, Vielberg MT, Szczepanowski RH, Kiefersauer R, Reed S, Groll M, Bochtler M. J Mol Biol. 2018 Mar 2;430(5):611-627. doi: 10.1016/j.jmb.2017.11.016. Epub 2017 Dec 16. 10.1016/j.jmb.2017.11.016 PubMed 29258816