-
PurposeThe encoded protein is the anti-HA frankenbody variant fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129596 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmCherry-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4722
- Total vector size (bp) 5539
-
Modifications to backboneNo modifications to backbone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnti-HA frankenbody variant-mCherry (2E2-HA scFv-mCherry)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1578
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TTTGTAACCATTATAAGCTGCAAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-2E2-HA-mCh was a gift from Tim Stasevich (Addgene plasmid # 129596 ; http://n2t.net/addgene:129596 ; RRID:Addgene_129596) -
For your References section:
A genetically encoded probe for imaging nascent and mature HA-tagged proteins in vivo. Zhao N, Kamijo K, Fox PD, Oda H, Morisaki T, Sato Y, Kimura H, Stasevich TJ. Nat Commun. 2019 Jul 3;10(1):2947. doi: 10.1038/s41467-019-10846-1. 10.1038/s41467-019-10846-1 PubMed 31270320