-
PurposeThe encoded protein is the anti-HA frankenbody variant fused with the mEGFP and His-tag. This plasmid is for bacteria protein expression under T7 promoter and protein purification with HisTrap.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129594 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepET23b
-
Backbone manufacturerMillipore Sigma
- Backbone size w/o insert (bp) 3666
- Total vector size (bp) 5162
-
Modifications to backboneNo modifications to backbone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnti-HA frankenbody variant-mEGFP (2E2-HA scFv-mEGFP)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1574
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET23b-2E2-HA-mEGFP-6xHis was a gift from Tim Stasevich (Addgene plasmid # 129594 ; http://n2t.net/addgene:129594 ; RRID:Addgene_129594) -
For your References section:
A genetically encoded probe for imaging nascent and mature HA-tagged proteins in vivo. Zhao N, Kamijo K, Fox PD, Oda H, Morisaki T, Sato Y, Kimura H, Stasevich TJ. Nat Commun. 2019 Jul 3;10(1):2947. doi: 10.1038/s41467-019-10846-1. 10.1038/s41467-019-10846-1 PubMed 31270320
Map uploaded by the depositor.
